TestUstad

Free Biological Molecules MCQs with Answers

1,790 Biological Molecules MCQs from Biology, each with the correct answer and a written explanation of why it is correct. Free and unlimited, with no account needed.

The chapter covers water's polarity and biological roles, carbohydrates, lipids, proteins and nucleic acids, including their monomers, bonds, structures and functions. It also distinguishes RNA from DNA and explains conjugated molecules such as glycoproteins, glycolipids and nucleoproteins, which combine organic molecules with a non-protein component.

Last updated

Classification of Biological MoleculesBiological Importance of WaterCarbohydratesProteinsLipidsRibonucleic Acid (RNA)Conjugated MoleculesStructure of DNA
Read the Biological Molecules notesFree MDCAT chapter notes with key terms

1,790 questions · page 72 of 90

1421. The function of RNA polymerase enzyme is to synthesise

  • A. mRNA from a DNA template
  • B. A polypeptide from mRNA template
  • C. mRNA from the molecules of tRNA
  • D. A strand of DNA from mRNA template

Explanation: RNA polymerase does not synthesize DNA from an mRNA template; that process is called reverse transcription and is carried out by the…

Read the full explanation →
Correct answer: mRNA from a DNA template

1422. Isoniazid is an antibiotic drug prescribed by physicians to treat tuberculosis (TB). It works by inhibiting the activity of RNA polymerase in the pathogenic bacterial cell. Which of the following process(es) will be directly affected in the bacterial cell by this inhibition?I. DNA replication.II. Transcription.III. ATP synthesis.

  • A. I only
  • B. II only
  • C. I and III
  • D. II and III

Explanation: The correct answer is Option B: II only. RNA polymerase is an enzyme that is critical for the process of transcription, where RNA is…

Read the full explanation →
Correct answer: II only

1423. The central dogma of molecular genetics states that the genetic information flows from:

  • A. Amino acids → Proteins → DNA
  • B. DNA → Carbohydrates → Proteins
  • C. DNA → RNA → Proteins
  • D. DNA → RNA → Carbohydrates

Explanation: This is the correct option. The central dogma of molecular genetics outlines the unidirectional flow of genetic information from DNA to…

Read the full explanation →
Correct answer: DNA → RNA → Proteins

1424. Which tRNA can bind at mRNA Condon UAC?

  • A. tRNA with anit-condon ACU
  • B. tRNA with anit-condon AUG
  • C. tRNA with anit-condon TGA
  • D. tRNA with anit-condon TCU

Explanation: The codon is a sequence of three bases on mRNA that determines an amino acid.

Read the full explanation →
Correct answer: tRNA with anit-condon AUG

1425. A sequence of three nucleotides called anticodon is part of

  • A. tRNA
  • B. cDNA
  • C. rRNA
  • D. mRNA

Explanation: The sequence of three nucleotides called an anticodon is part of a transfer RNA (tRNA) molecule.

Read the full explanation →
Correct answer: tRNA

1426. Which tRNA can bind at mRNA codon UGA?

  • A. tRNA with anticodon ACU
  • B. tRNA with anticodon ACT
  • C. tRNA with anticodon TGA
  • D. tRNA with anticodon TCU

Explanation: A sequence of three nucleotides on a tRNA molecule that bond to a complementary sequence on an mRNA molecule.

Read the full explanation →
Correct answer: tRNA with anticodon ACU

1427. An mRNA codon for the amino acid alanine is GCC. How many alanine molecules are present in the polypeptide, containing 8 amino acids coded for by the following DNA template?TCGGCCTACCGGGCCCATGCCAAT

  • A. Zero
  • B. One
  • C. Two
  • D. Three

Explanation: To determine the number of alanine molecules present in the polypeptide, we need to count the number of occurrences of the mRNA codon…

Read the full explanation →
Correct answer: Three

1428. During translation, the amino acyl t-RNA complex attaches to small ribosomal unit at

  • A. P site
  • B. E site
  • C. mRNA
  • D. A site

Explanation: During translation, the aminoacyl-tRNA complex attaches to the small ribosomal subunit at the A site (Answer D) of the ribosome.

Read the full explanation →
Correct answer: A site

1429. All of the following are Stop Codons EXCEPT

  • A. UGA
  • B. UAG
  • C. UAA
  • D. AUG

Explanation: AUG is not a stop codon; it is the start codon (specifically, the initiation codon) that signals the beginning of protein synthesis during…

Read the full explanation →
Correct answer: AUG

1430. Which type of RNA is most abundant in the cell?

  • A. mRNA
  • B. tRNA
  • C. rRNA
  • D. sRNA

Explanation: Ribosomal RNA (rRNA) is the most abundant type of RNA in the cell. It is a component of the ribosome, which is the cellular machinery that…

Read the full explanation →
Correct answer: rRNA

1431. The DNA analysis of a fruit fly shows that 22% of nitrogenous bases are thymine.The percentage of guanine bases in this DNA would be

  • A. 22%
  • B. 28%
  • C. 44%
  • D. 56%

Explanation: In DNA, the amount of adenine (A) equals the amount of thymine (T), and the amount of guanine (G) equals the amount of cytosine (C).

Read the full explanation →
Correct answer: 28%

1432. A polypeptide chain contains 120 amino acids.The number of DNA nucleotides that would be required to code for this polypeptide chain are

  • A. 40
  • B. 120
  • C. 360
  • D. 480

Explanation: A polypeptide chain containing 120 amino acids requires a specific number of DNA nucleotides to be coded.

Read the full explanation →
Correct answer: 360

1433. The given diagram shows DNA sequence obtained by dideoxy chain termination (Sanger) method.The given DNA sequence will be read as:

  • A. CGATGGCCTGTCTTCAGAAA
  • B. AAAGACTTCTGCCCGGTAGC
  • C. AAAAACCCCCGGGGGTTTTT
  • D. ACGTGGCCGTTTTCCGAAAA

Explanation: The Sanger sequencing method, or dideoxy chain termination method, involves reading the DNA sequence from the gel electrophoresis results.

Read the full explanation →
Correct answer: CGATGGCCTGTCTTCAGAAA

1434. A section of deoxyribonucleic acid (DNA) contains the following sequence of bases.The number of amino acids that the given section of DNA can code is

  • A. 3
  • B. 4
  • C. 6
  • D. 12

Explanation: The section of DNA mentioned in the question can code for amino acids based on groups of three nucleotide bases, known as codons.

Read the full explanation →
Correct answer: 4

1435. Consider the given table related to four DNA nucleotides (I, II, III and IV).During DNA duplication, the nucleotide that can pair with an adenine base is

  • A. I
  • B. II
  • C. III
  • D. IV

Explanation: Adenine pairs with thymine in DNA replication. Thymine has a single ring in its structure, and the carbon-to-oxygen ratio in pentose is…

Read the full explanation →
Correct answer: I

1436. A section of a double-stranded DNA contains 150 nucleotides and codes for a polypeptide X.The number of amino acids in polypeptide X will be

  • A. 25 amino acids
  • B. 150 amino acids
  • C. 75 amino acids
  • D. 50 amino acids

Explanation: A section of DNA with 150 nucleotides will code for a polypeptide through a process where every three nucleotides (a codon) correspond to…

Read the full explanation →
Correct answer: 50 amino acids

1437. The given table shows the genetic codes of two different amino acids which exemplifies one of the features of genetic codes. Which of the following statements is CORRECT about this feature?

  • A. Genetic codes are redundant
  • B. Genetic codes are ambiguous
  • C. Each amino acid has only one genetic code
  • D. Three genetic codes are used for stop signal

Explanation: The correct answer is that genetic codes are redundant. This means that multiple codons can encode the same amino acid, providing a buffer…

Read the full explanation →
Correct answer: Genetic codes are redundant

1438. The number of phosphodiester bonds in a double stranded fragment of DNA with fournucleotides in each strand is

  • A. 3
  • B. 4
  • C. 6
  • D. 8

Explanation: In a DNA strand, each nucleotide is connected to the next by a phosphodiester bond.

Read the full explanation →
Correct answer: 6

1439. The step(s) that occur(s) during DNA replication is/are:I. Breakage of phosphodiester bonds.II. Breakage and reformation of hydrogen bonds.III. Binding of free nucleotides with their complementary bases.

  • A. I only
  • B. I and II
  • C. III only
  • D. II and III

Explanation: The correct answer is II and III. During DNA replication, the hydrogen bonds between the base pairs of the two DNA strands are temporarily…

Read the full explanation →
Correct answer: II and III

1440. In Sanger's method of DNA sequencing, dideoxynucleotides terminate the elongation of DNA during replication. This is because the 3` carbon of dideoxynucleotides:

  • A. Lack a hydroxyl group
  • B. Lack a hydrogen group
  • C. Have a nitrogenous base
  • D. Have a phosphate group

Explanation: The correct answer is that dideoxy nucleotides lack a hydroxyl group at the 3 carbon.

Read the full explanation →
Correct answer: Lack a hydroxyl group
Start Free Biological Molecules Practice MCQs Test