Free Biological Molecules MCQs with Answers
1,790 Biological Molecules MCQs from Biology, each with the correct answer and a written explanation of why it is correct. Free and unlimited, with no account needed.
The chapter covers water's polarity and biological roles, carbohydrates, lipids, proteins and nucleic acids, including their monomers, bonds, structures and functions. It also distinguishes RNA from DNA and explains conjugated molecules such as glycoproteins, glycolipids and nucleoproteins, which combine organic molecules with a non-protein component.
Last updated
1,790 questions · page 73 of 90
- A. Cell to cell recognition
- B. Passing hereditary information to the next generation
- C. Ensuring fast speed of nerve impulse
- D. Acting as a cell surface marker
Explanation: This is correct as Nucleoproteins are complexes of nucleic acids (DNA or RNA) and proteins.
Correct answer: Passing hereditary information to the next generation- A. Degeneracy
- B. Splicing
- C. Proofreading
- D. Primosome
Explanation: In proofreading, the DNA pol reads the newly added base before adding the next one, so a correction can be made.
Correct answer: Proofreading- A. GATC
- B. GGTT
- C. CGAT
- D. TTCC
Explanation: A palindromic sequence is a nucleic acid sequence in a double-stranded DNA or RNA molecule whereby reading in a certain direction on one…
Correct answer: TTCC- A. Each strand with one new strand and one original strand
- B. Each with two new strands
- C. One with two new strands and one with both original strands
- D. Each with two original strands
Explanation: This is correct. In the semi-conservative model, during DNA replication, each original DNA strand serves as a template for the synthesis…
Correct answer: Each strand with one new strand and one original strand- A. 4
- B. 16
- C. 20
- D. 64
Explanation: Since there are four nucleotides and each trinucleotide consists of three bases, the total number of possible combinations is 43 = 64.
Correct answer: 64- A. DNA polymerase
- B. Ligase
- C. Nucleotides
- D. Primers
Explanation: Given the description of defective DNA molecules formed with normal DNA strands paired with numerous segments of DNA, the most likely…
Correct answer: Primers- A. ACACUAGUGAUGCUAUUCGU
- B. ACACTAGTGATGCTAAACGTG
- C. ACACTAGTGATCCTATTCGTG
- D. CACATCUTUCTUATCTTAUTU
Explanation: The mRNA codons corresponding to the amino acids are:1 (UGU) = Cysteine (Cys)2 (GAU) = Aspartic acid (Asp)3 (CAC) = Histidine (His)4 (UAG)…
Correct answer: CACATCUTUCTUATCTTAUTU- A. 5′-ATGCCAGTA-3′
- B. 5′-ATGACCGTA-3′
- C. 3′-TACGGTCAT-5′
- D. 3′-ATGCCAGTA-5′
Explanation: D is correct one. In the Sanger method, DNA sequencing is achieved by replicating the DNA strand in the presence of chain-terminating…
Correct answer: 3′-ATGCCAGTA-5′- A. Consists of few DNA nucleotides
- B. Helps lo unwind DNA double strand
- C. Prevents DNA strands to pair up
- D. Is a short segment of RNA nucleotides
Explanation: DNA polymerase - an enzyme that adds new nucleotides to a growing strand of DNA.
Correct answer: Is a short segment of RNA nucleotides- A. 0 minutes
- B. 20 minutes
- C. 40 minutes
- D. 60 minutes
Explanation: Right after adding the N15 label, the DNA sample would contain only the heavy isotope N15, so it would appear heaviest at this point.
Correct answer: 0 minutes- A. 20
- B. 27
- C. 15
- D. All
Explanation: X-ray analysis has shown that on the average there are 27 amino acid units for each turn of the helix.
Correct answer: 27- A. Adenine
- B. Guanine
- C. Thymine
- D. Cytosine
Explanation: DNA and RNA differ in three ways. 1. The sugar in RNA is ribose while the sugar in DNA is 2-deoxyribose. 2.
Correct answer: Thymine- A. 85%
- B. 95%
- C. 97%
- D. 73%
Explanation: The commonly quoted water content of the human brain is about 73%, reflecting the high water requirement of nervous tissue for metabolism…
Correct answer: 73%- A. 1-2%
- B. 3-4%
- C. 5-7%
- D. 90%
Explanation: Cuticular transpiration is a small fraction of total transpiration, commonly given in this syllabus as about 5% to 7%, so 5% to 7% is the…
Correct answer: 5-7%- A. Galactose
- B. Gluconic acid
- C. B-methyl galactoside
- D. Sucrose
Explanation: All those sugars which have free aldehyde or ketone group are called reducing sugars.
Correct answer: Galactose- A. Nerve cells
- B. Bone cells
- C. Brain cells
- D. None of the above
Explanation: Water varies from os to 89 percent in different organisms, Human tissues contain about 20% water in bone cells and 85 percent in brain…
Correct answer: Brain cells- A. Butyric acid
- B. Stearic acid
- C. Oleic acid
- D. Palmitic acid
Explanation: Butyric acid, palmitic acid and stearic acids examples of saturated fatty acids.
Correct answer: Oleic acid- A. 1st carbon & 2nd carbon
- B. Only 1st carbon
- C. 1st carbon and 5th carbon
- D. 1st carbon and 6th carbon
Explanation: 1st and 2nd Carbon: This option suggests that the 1st and 2nd carbon atoms are present outside the ring of fructose.
Correct answer: 1st carbon and 6th carbon- A. Primary structure
- B. Secondary structure
- C. Quaternary structure
- D. Tertiary structure
Explanation: The tertiary structure of an enzyme refers to the three-dimensional arrangement of its polypeptide chain, including the interactions…
Correct answer: Tertiary structure- A. Coordinated catabolic activities
- B. Coordinated anabolic activities
- C. Both A and B
- D. None of these
Explanation: Interconversion involves both breaking down and building up molecules, requiring both catabolic and anabolic activities to work in…
Correct answer: Both A and B