Five different amino acids (number 1-5 below) from the following sequence is part of a polypeptide chain1 - 2 - 3 - 4 - 2 - 5 - 3and mRNA codons which corresponds to these amino acids are1=UGU, 2=GAU, 3=CAC, 4=UAG, 5=AAG.Which one of the following DNA base sequences could provide the code for the give section of polypeptide?
Correct answer: D. CACATCUTUCTUATCTTAUTU
- A. ACACUAGUGAUGCUAUUCGU
- B. ACACTAGTGATGCTAAACGTG
- C. ACACTAGTGATCCTATTCGTG
- D. CACATCUTUCTUATCTTAUTU
Explanation
The mRNA codons corresponding to the amino acids are:1 (UGU) = Cysteine (Cys)2 (GAU) = Aspartic acid (Asp)3 (CAC) = Histidine (His)4 (UAG) = Stop codon5 (AAG) = Lysine (Lys)So, the sequence of amino acids from the mRNA codons is Cys-Asp-His-Stop-Asp-Lys-His, which corresponds to the polypeptide sequence CAC-ATC-STOP-ATC-AAG-CAC.
Last updated
About Structure of DNA
DNA structure includes nucleotides made of deoxyribose, phosphate and nitrogenous bases, arranged in two antiparallel polynucleotide strands. Questions cover the double helix, phosphodiester and hydrogen bonds, complementary base pairing between adenine and thymine and between guanine and cytosine, and the significance of major and minor grooves.
Practise Biological Molecules
1,790 free Biological Molecules MCQs from Biology, each with the correct answer and an explanation. Unlimited attempts, no account needed.
Exams that ask Biology questions like this
Biology is on 6 papers prepared for on TestUstad, and all of them draw the same bank, so this question is worth knowing for every one of them.
Related questions
A biochemist isolated and purified molecules needed for DNA replication. When he added some DNA, replication occurred, but the DNA molecules formed were defective. Each consisted of normal DNA strand paired with numerous segments of DNA, a few hundred nucleotides long. What had the scientist probably left out of the mixture?
A genome is___________?
A polypeptide chain contains 120 amino acids.The number of DNA nucleotides that would be required to code for this polypeptide chain are
A section of a double-stranded DNA contains 150 nucleotides and codes for a polypeptide X.The number of amino acids in polypeptide X will be
A section of deoxyribonucleic acid (DNA) contains the following sequence of bases.The number of amino acids that the given section of DNA can code is