An mRNA codon for the amino acid alanine is GCC. How many alanine molecules are present in the polypeptide, containing 8 amino acids coded for by the following DNA template?TCGGCCTACCGGGCCCATGCCAAT
Correct answer: D. Three
- A. Zero
- B. One
- C. Two
- D. Three
Explanation
To determine the number of alanine molecules present in the polypeptide, we need to count the number of occurrences of the mRNA codon "GCC" in the DNA template sequence.Given the DNA template sequence:TCGGCCTACCGGGCCCATGCCAATThe number of times "GCC" occurs:- There are 3 occurrences of "GCC" in the sequence.Each "GCC" codon codes for one alanine molecule. Therefore, there are 3 alanine molecules present in the polypeptide.
Last updated
About Ribonucleic Acid (RNA)
Ribonucleic acid is generally a single-stranded nucleic acid containing ribose and uracil instead of thymine. Coverage includes mRNA, tRNA and rRNA, complementary base pairing, transcription and translation, and the differences between RNA and DNA in structure, location and biological function.
Practise Biological Molecules
1,790 free Biological Molecules MCQs from Biology, each with the correct answer and an explanation. Unlimited attempts, no account needed.
Exams that ask Biology questions like this
Biology is on 6 papers prepared for on TestUstad, and all of them draw the same bank, so this question is worth knowing for every one of them.
Related questions
"80-S" ribosome is formed by the combination of:
A group of ribosomes attached to mRNA are known as:
A group of ribosomes attached to mRNA is known as___________?
A group of ribosomes attached to mRNA is known as a polysome and the attachment is controlled by:
A sequence of three nucleotides called anticodon is part of