An mRNA codon for the amino acid alanine is GCC. How many alanine molecules are present in the polypeptide, containing 8 amino acids coded for by the following DNA template?TCGGCCTACCGGGCCCATGCCAAT
Correct answer: D. Three
- A. Zero
- B. One
- C. Two
- D. Three
Explanation
To determine the number of alanine molecules present in the polypeptide, we need to count the number of occurrences of the mRNA codon "GCC" in the DNA template sequence.Given the DNA template sequence:TCGGCCTACCGGGCCCATGCCAATThe number of times "GCC" occurs:- There are 3 occurrences of "GCC" in the sequence.Each "GCC" codon codes for one alanine molecule. Therefore, there are 3 alanine molecules present in the polypeptide.
Report an error
The more specific you are, the faster it gets fixed. A source beats an opinion.
Prefer email? [email protected]
About Ribonucleic Acid (RNA)
Ribonucleic acid is generally a single-stranded nucleic acid containing ribose and uracil instead of thymine. Coverage includes mRNA, tRNA and rRNA, complementary base pairing, transcription and translation, and the differences between RNA and DNA in structure, location and biological function.
Practise Biological Molecules
1,790 free Biological Molecules MCQs from Biology, each with the correct answer and an explanation. Unlimited attempts, no account needed.
Discussion
Stuck on an option, or know a faster way to get there? Ask or explain it here.
No comments yet. Be the first to explain this one.
Exams that ask Biology questions like this
Biology is on 8 papers prepared for on TestUstad, and all of them draw the same bank, so this question is worth knowing for every one of them.
More Ribonucleic Acid (RNA) questions
Which tRNA can bind at mRNA codon UGA?
A sequence of three nucleotides called anticodon is part of
Which tRNA can bind at mRNA Condon UAC?
During translation, the amino acyl t-RNA complex attaches to small ribosomal unit at
All of the following are Stop Codons EXCEPT
Which type of RNA is most abundant in the cell?