Asked in FBISE Biology 2022 SLO — Paper 3 2022Moderate

An mRNA codon for the amino acid alanine is GCC. How many alanine molecules are present in the polypeptide, containing 8 amino acids coded for by the following DNA template?TCGGCCTACCGGGCCCATGCCAAT

Correct answer: D. Three

  • A. Zero
  • B. One
  • C. Two
  • D. Three

Explanation

To determine the number of alanine molecules present in the polypeptide, we need to count the number of occurrences of the mRNA codon "GCC" in the DNA template sequence.Given the DNA template sequence:TCGGCCTACCGGGCCCATGCCAATThe number of times "GCC" occurs:- There are 3 occurrences of "GCC" in the sequence.Each "GCC" codon codes for one alanine molecule. Therefore, there are 3 alanine molecules present in the polypeptide.

Last updated

About Ribonucleic Acid (RNA)

Ribonucleic acid is generally a single-stranded nucleic acid containing ribose and uracil instead of thymine. Coverage includes mRNA, tRNA and rRNA, complementary base pairing, transcription and translation, and the differences between RNA and DNA in structure, location and biological function.

Practise Biological Molecules

1,790 free Biological Molecules MCQs from Biology, each with the correct answer and an explanation. Unlimited attempts, no account needed.

Exams that ask Biology questions like this

Biology is on 6 papers prepared for on TestUstad, and all of them draw the same bank, so this question is worth knowing for every one of them.

Related questions