A sequence of three nucleotides called anticodon is part of
Correct answer: A. tRNA
- A. tRNA
- B. cDNA
- C. rRNA
- D. mRNA
Explanation
The sequence of three nucleotides called an anticodon is part of a transfer RNA (tRNA) molecule. The anticodon is complementary to a specific codon on mRNA during protein synthesis and helps to ensure the correct amino acid is brought to the ribosome during translation.
Report an error
The more specific you are, the faster it gets fixed. A source beats an opinion.
Prefer email? support@testustad.com
About Ribonucleic Acid (RNA)
Ribonucleic acid is generally a single-stranded nucleic acid containing ribose and uracil instead of thymine. Coverage includes mRNA, tRNA and rRNA, complementary base pairing, transcription and translation, and the differences between RNA and DNA in structure, location and biological function.
Practise Biological Molecules
1,790 free Biological Molecules MCQs from Biology, each with the correct answer and an explanation. Unlimited attempts, no account needed.
Discussion
Stuck on an option, or know a faster way to get there? Ask or explain it here.
No comments yet. Be the first to explain this one.
Exams that ask Biology questions like this
Biology is on 8 papers prepared for on TestUstad, and all of them draw the same bank, so this question is worth knowing for every one of them.
More Ribonucleic Acid (RNA) questions
Which tRNA can bind at mRNA Condon UAC?
The central dogma of molecular genetics states that the genetic information flows from:
Isoniazid is an antibiotic drug prescribed by physicians to treat tuberculosis (TB). It works by inhibiting the activity of RNA polymerase in the pathogenic bacterial cell. Which of the following process(es) will be directly affected in the bacterial cell by this inhibition?I. DNA replication.II. Transcription.III. ATP synthesis.
Which tRNA can bind at mRNA codon UGA?
An mRNA codon for the amino acid alanine is GCC. How many alanine molecules are present in the polypeptide, containing 8 amino acids coded for by the following DNA template?TCGGCCTACCGGGCCCATGCCAAT
During translation, the amino acyl t-RNA complex attaches to small ribosomal unit at