Which tRNA can bind at mRNA codon UGA?
Correct answer: A. tRNA with anticodon ACU
- A. tRNA with anticodon ACU
- B. tRNA with anticodon ACT
- C. tRNA with anticodon TGA
- D. tRNA with anticodon TCU
Explanation
A sequence of three nucleotides on a tRNA molecule that bond to a complementary sequence on an mRNA molecule. The anticodon sequence determines the amino acid that the tRNA carries.
Report an error
The more specific you are, the faster it gets fixed. A source beats an opinion.
Prefer email? [email protected]
About Ribonucleic Acid (RNA)
Ribonucleic acid is generally a single-stranded nucleic acid containing ribose and uracil instead of thymine. Coverage includes mRNA, tRNA and rRNA, complementary base pairing, transcription and translation, and the differences between RNA and DNA in structure, location and biological function.
Practise Biological Molecules
1,790 free Biological Molecules MCQs from Biology, each with the correct answer and an explanation. Unlimited attempts, no account needed.
Discussion
Stuck on an option, or know a faster way to get there? Ask or explain it here.
No comments yet. Be the first to explain this one.
Exams that ask Biology questions like this
Biology is on 8 papers prepared for on TestUstad, and all of them draw the same bank, so this question is worth knowing for every one of them.
More Ribonucleic Acid (RNA) questions
A sequence of three nucleotides called anticodon is part of
Which tRNA can bind at mRNA Condon UAC?
The central dogma of molecular genetics states that the genetic information flows from:
An mRNA codon for the amino acid alanine is GCC. How many alanine molecules are present in the polypeptide, containing 8 amino acids coded for by the following DNA template?TCGGCCTACCGGGCCCATGCCAAT
During translation, the amino acyl t-RNA complex attaches to small ribosomal unit at
All of the following are Stop Codons EXCEPT