All of the following are Stop Codons EXCEPT
Correct answer: D. AUG
- A. UGA
- B. UAG
- C. UAA
- D. AUG
Explanation
AUG is not a stop codon; it is the start codon (specifically, the initiation codon) that signals the beginning of protein synthesis during translation. UGA, UAG, and UAA are the three stop codons, also known as termination codons, that signal the end of the protein-coding sequence.
Report an error
The more specific you are, the faster it gets fixed. A source beats an opinion.
Prefer email? [email protected]
About Ribonucleic Acid (RNA)
Ribonucleic acid is generally a single-stranded nucleic acid containing ribose and uracil instead of thymine. Coverage includes mRNA, tRNA and rRNA, complementary base pairing, transcription and translation, and the differences between RNA and DNA in structure, location and biological function.
Practise Biological Molecules
1,790 free Biological Molecules MCQs from Biology, each with the correct answer and an explanation. Unlimited attempts, no account needed.
Discussion
Stuck on an option, or know a faster way to get there? Ask or explain it here.
No comments yet. Be the first to explain this one.
Exams that ask Biology questions like this
Biology is on 8 papers prepared for on TestUstad, and all of them draw the same bank, so this question is worth knowing for every one of them.
More Ribonucleic Acid (RNA) questions
During translation, the amino acyl t-RNA complex attaches to small ribosomal unit at
An mRNA codon for the amino acid alanine is GCC. How many alanine molecules are present in the polypeptide, containing 8 amino acids coded for by the following DNA template?TCGGCCTACCGGGCCCATGCCAAT
Which tRNA can bind at mRNA codon UGA?
Which type of RNA is most abundant in the cell?
RNA contains four different nitrogenous bases EXCEPT.
Which of the following is the constituent of RNA molecule?