Which type of RNA is most abundant in the cell?
Correct answer: C. rRNA
- A. mRNA
- B. tRNA
- C. rRNA
- D. sRNA
Explanation
Ribosomal RNA (rRNA) is the most abundant type of RNA in the cell. It is a component of the ribosome, which is the cellular machinery that translates mRNA into proteins. rRNA accounts for about 80% of the total RNA in the cell.
This question appeared on the NUMS 2019 (cancelled sitting) paper, which you can sit online with every answer explained.
Report an error
The more specific you are, the faster it gets fixed. A source beats an opinion.
Prefer email? [email protected]
About Ribonucleic Acid (RNA)
Ribonucleic acid is generally a single-stranded nucleic acid containing ribose and uracil instead of thymine. Coverage includes mRNA, tRNA and rRNA, complementary base pairing, transcription and translation, and the differences between RNA and DNA in structure, location and biological function.
Practise Biological Molecules
1,790 free Biological Molecules MCQs from Biology, each with the correct answer and an explanation. Unlimited attempts, no account needed.
Discussion
Stuck on an option, or know a faster way to get there? Ask or explain it here.
No comments yet. Be the first to explain this one.
Exams that ask Biology questions like this
Biology is on 8 papers prepared for on TestUstad, and all of them draw the same bank, so this question is worth knowing for every one of them.
More Ribonucleic Acid (RNA) questions
All of the following are Stop Codons EXCEPT
During translation, the amino acyl t-RNA complex attaches to small ribosomal unit at
An mRNA codon for the amino acid alanine is GCC. How many alanine molecules are present in the polypeptide, containing 8 amino acids coded for by the following DNA template?TCGGCCTACCGGGCCCATGCCAAT
RNA contains four different nitrogenous bases EXCEPT.
Which of the following is the constituent of RNA molecule?
In mitochondria, UGA codon act to specify _ instead stop codon.