Which tRNA can bind at mRNA Condon UAC?
Correct answer: B. tRNA with anit-condon AUG
- A. tRNA with anit-condon ACU
- B. tRNA with anit-condon AUG
- C. tRNA with anit-condon TGA
- D. tRNA with anit-condon TCU
Explanation
The codon is a sequence of three bases on mRNA that determines an amino acid. The anticodon is a sequence of tRNA that is complementary to the codon. From the question, first, write the antiparallel sequence for the codon based on the tRNA anticodon. In this example, the anticodon is UAC. Thus, the codon would be AUG.
Report an error
The more specific you are, the faster it gets fixed. A source beats an opinion.
Prefer email? [email protected]
About Ribonucleic Acid (RNA)
Ribonucleic acid is generally a single-stranded nucleic acid containing ribose and uracil instead of thymine. Coverage includes mRNA, tRNA and rRNA, complementary base pairing, transcription and translation, and the differences between RNA and DNA in structure, location and biological function.
Practise Biological Molecules
1,790 free Biological Molecules MCQs from Biology, each with the correct answer and an explanation. Unlimited attempts, no account needed.
Discussion
Stuck on an option, or know a faster way to get there? Ask or explain it here.
No comments yet. Be the first to explain this one.
Exams that ask Biology questions like this
Biology is on 8 papers prepared for on TestUstad, and all of them draw the same bank, so this question is worth knowing for every one of them.
More Ribonucleic Acid (RNA) questions
The central dogma of molecular genetics states that the genetic information flows from:
Isoniazid is an antibiotic drug prescribed by physicians to treat tuberculosis (TB). It works by inhibiting the activity of RNA polymerase in the pathogenic bacterial cell. Which of the following process(es) will be directly affected in the bacterial cell by this inhibition?I. DNA replication.II. Transcription.III. ATP synthesis.
The function of RNA polymerase enzyme is to synthesise
A sequence of three nucleotides called anticodon is part of
Which tRNA can bind at mRNA codon UGA?
An mRNA codon for the amino acid alanine is GCC. How many alanine molecules are present in the polypeptide, containing 8 amino acids coded for by the following DNA template?TCGGCCTACCGGGCCCATGCCAAT