The given diagram shows DNA sequence obtained by dideoxy chain termination (Sanger) method.The given DNA sequence will be read as:
Correct answer: A. CGATGGCCTGTCTTCAGAAA
- A. CGATGGCCTGTCTTCAGAAA
- B. AAAGACTTCTGCCCGGTAGC
- C. AAAAACCCCCGGGGGTTTTT
- D. ACGTGGCCGTTTTCCGAAAA
Explanation
The Sanger sequencing method, or dideoxy chain termination method, involves reading the DNA sequence from the gel electrophoresis results. The sequence is read from bottom to top,CGATGGCCTGTCTTCAGAAABy doing so, option A is correct. All other options are not the correct base sequences in DNA.
Report an error
The more specific you are, the faster it gets fixed. A source beats an opinion.
Prefer email? [email protected]
About Structure of DNA
DNA structure includes nucleotides made of deoxyribose, phosphate and nitrogenous bases, arranged in two antiparallel polynucleotide strands. Questions cover the double helix, phosphodiester and hydrogen bonds, complementary base pairing between adenine and thymine and between guanine and cytosine, and the significance of major and minor grooves.
Practise Biological Molecules
1,790 free Biological Molecules MCQs from Biology, each with the correct answer and an explanation. Unlimited attempts, no account needed.
Discussion
Stuck on an option, or know a faster way to get there? Ask or explain it here.
No comments yet. Be the first to explain this one.
Exams that ask Biology questions like this
Biology is on 8 papers prepared for on TestUstad, and all of them draw the same bank, so this question is worth knowing for every one of them.
More Structure of DNA questions
A polypeptide chain contains 120 amino acids.The number of DNA nucleotides that would be required to code for this polypeptide chain are
The DNA analysis of a fruit fly shows that 22% of nitrogenous bases are thymine.The percentage of guanine bases in this DNA would be
Okazaki fragments are connected together through action of_________________?
A section of deoxyribonucleic acid (DNA) contains the following sequence of bases.The number of amino acids that the given section of DNA can code is
Consider the given table related to four DNA nucleotides (I, II, III and IV).During DNA duplication, the nucleotide that can pair with an adenine base is
A section of a double-stranded DNA contains 150 nucleotides and codes for a polypeptide X.The number of amino acids in polypeptide X will be