Free Structure of DNA MCQs with Answers
69 Structure of DNA MCQs from Biology, each with the correct answer and a written explanation of why it is correct. Free and unlimited, with no account needed.
DNA structure includes nucleotides made of deoxyribose, phosphate and nitrogenous bases, arranged in two antiparallel polynucleotide strands. Questions cover the double helix, phosphodiester and hydrogen bonds, complementary base pairing between adenine and thymine and between guanine and cytosine, and the significance of major and minor grooves.
Last updated
69 questions · page 2 of 4
- A. F.Miescher
- B. Chargaff
- C. Watson & Crick
- D. Harshay & Chase
Explanation: Chargaff showed that DNA contains approximately equal amounts of purines and pyrimidines because adenine pairs with thymine and guanine…
Correct answer: Chargaff- A. Primase
- B. Polymerase
- C. Helicase
- D. Ligase
Explanation: DNA ligase joins Okazaki fragments on the lagging strand by sealing breaks in the sugar-phosphate backbone and forming phosphodiester…
Correct answer: Ligase- A. 22%
- B. 28%
- C. 44%
- D. 56%
Explanation: In DNA, the amount of adenine (A) equals the amount of thymine (T), and the amount of guanine (G) equals the amount of cytosine (C).
Correct answer: 28%- A. 40
- B. 120
- C. 360
- D. 480
Explanation: A polypeptide chain containing 120 amino acids requires a specific number of DNA nucleotides to be coded.
Correct answer: 360- A. CGATGGCCTGTCTTCAGAAA
- B. AAAGACTTCTGCCCGGTAGC
- C. AAAAACCCCCGGGGGTTTTT
- D. ACGTGGCCGTTTTCCGAAAA
Explanation: The Sanger sequencing method, or dideoxy chain termination method, involves reading the DNA sequence from the gel electrophoresis results.
Correct answer: CGATGGCCTGTCTTCAGAAA- A. 3
- B. 4
- C. 6
- D. 12
Explanation: The section of DNA mentioned in the question can code for amino acids based on groups of three nucleotide bases, known as codons.
Correct answer: 4- A. I
- B. II
- C. III
- D. IV
Explanation: Adenine pairs with thymine in DNA replication. Thymine has a single ring in its structure, and the carbon-to-oxygen ratio in pentose is…
Correct answer: I- A. 25 amino acids
- B. 150 amino acids
- C. 75 amino acids
- D. 50 amino acids
Explanation: A section of DNA with 150 nucleotides will code for a polypeptide through a process where every three nucleotides (a codon) correspond to…
Correct answer: 50 amino acids- A. Genetic codes are redundant
- B. Genetic codes are ambiguous
- C. Each amino acid has only one genetic code
- D. Three genetic codes are used for stop signal
Explanation: The correct answer is that genetic codes are redundant. This means that multiple codons can encode the same amino acid, providing a buffer…
Correct answer: Genetic codes are redundant- A. 3
- B. 4
- C. 6
- D. 8
Explanation: In a DNA strand, each nucleotide is connected to the next by a phosphodiester bond.
Correct answer: 6- A. I only
- B. I and II
- C. III only
- D. II and III
Explanation: The correct answer is II and III. During DNA replication, the hydrogen bonds between the base pairs of the two DNA strands are temporarily…
Correct answer: II and III- A. Lack a hydroxyl group
- B. Lack a hydrogen group
- C. Have a nitrogenous base
- D. Have a phosphate group
Explanation: The correct answer is that dideoxy nucleotides lack a hydroxyl group at the 3 carbon.
Correct answer: Lack a hydroxyl group- A. Cell to cell recognition
- B. Passing hereditary information to the next generation
- C. Ensuring fast speed of nerve impulse
- D. Acting as a cell surface marker
Explanation: This is correct as Nucleoproteins are complexes of nucleic acids (DNA or RNA) and proteins.
Correct answer: Passing hereditary information to the next generation- A. Degeneracy
- B. Splicing
- C. Proofreading
- D. Primosome
Explanation: In proofreading, the DNA pol reads the newly added base before adding the next one, so a correction can be made.
Correct answer: Proofreading- A. GATC
- B. GGTT
- C. CGAT
- D. TTCC
Explanation: A palindromic sequence is a nucleic acid sequence in a double-stranded DNA or RNA molecule whereby reading in a certain direction on one…
Correct answer: TTCC- A. Each strand with one new strand and one original strand
- B. Each with two new strands
- C. One with two new strands and one with both original strands
- D. Each with two original strands
Explanation: This is correct. In the semi-conservative model, during DNA replication, each original DNA strand serves as a template for the synthesis…
Correct answer: Each strand with one new strand and one original strand- A. 4
- B. 16
- C. 20
- D. 64
Explanation: Since there are four nucleotides and each trinucleotide consists of three bases, the total number of possible combinations is 43 = 64.
Correct answer: 64- A. DNA polymerase
- B. Ligase
- C. Nucleotides
- D. Primers
Explanation: Given the description of defective DNA molecules formed with normal DNA strands paired with numerous segments of DNA, the most likely…
Correct answer: Primers- A. ACACUAGUGAUGCUAUUCGU
- B. ACACTAGTGATGCTAAACGTG
- C. ACACTAGTGATCCTATTCGTG
- D. CACATCUTUCTUATCTTAUTU
Explanation: The mRNA codons corresponding to the amino acids are:1 (UGU) = Cysteine (Cys)2 (GAU) = Aspartic acid (Asp)3 (CAC) = Histidine (His)4 (UAG)…
Correct answer: CACATCUTUCTUATCTTAUTU- A. 5′-ATGCCAGTA-3′
- B. 5′-ATGACCGTA-3′
- C. 3′-TACGGTCAT-5′
- D. 3′-ATGCCAGTA-5′
Explanation: D is correct one. In the Sanger method, DNA sequencing is achieved by replicating the DNA strand in the presence of chain-terminating…
Correct answer: 3′-ATGCCAGTA-5′