All Free Biology MCQs with Answers

Every Biology question in the bank, across all chapters, each with the correct answer and a written explanation. Free and unlimited, with no account needed.

19,844 questions · page 814 of 993

  • A. Gonorrhea
  • B. Syphilis
  • C. AIDS
  • D. Measles

Explanation: Measles is an acute viral respiratory illness. It is characterized by a prodrome of fever (as high as 105°F) and malaise, cough, coryza…

Correct answer: Measles
  • A. Syphilis
  • B. Measles
  • C. Polio
  • D. Tetanus

Explanation: Syphilis is considered a sexually transmitted disease (STD) because it is primarily spread through sexual contact, including vaginal…

Correct answer: Syphilis
  • A. Memory cells are produced in the plasma
  • B. Lymphocytes are produced in the bone marrow
  • C. T-lymphocytes are required to stimulate the immune system
  • D. Antibodies are required to increase the production of B-lymphocytes

Explanation: Memory cells are specialized Lymphocytes that enable a faster response on re-exposure to same pathogen.

Correct answer: Memory cells are produced in the plasma
  • A. Natural active
  • B. Natural passive
  • C. Artificial active
  • D. Artificial passive

Explanation: The correct answer is artificial passive immunity. This type of immunity occurs when antibodies are directly introduced into the body…

Correct answer: Artificial passive
  • A. Active and natural
  • B. Active and artificial
  • C. Passive and natural
  • D. Passive and artificial

Explanation: Active artificial immunity is acquired through vaccination but does not provide immediate protection as it requires time for the body to…

Correct answer: Active and artificial
  • A. Innate immunity
  • B. Passive immunity
  • C. Primary response
  • D. Secondary response

Explanation: Secondary response is faster and stronger due to memory cells.

Correct answer: Secondary response
  • A. Natural active
  • B. Artificial active
  • C. Natural passive
  • D. Artificial passive

Explanation: Artificial active immunity is the foundation for vaccination. It involves the activation of adaptive immunity through the deliberate…

Correct answer: Artificial active
  • A. Antibiotic
  • B. Pain killers
  • C. Vaccine
  • D. Sedatives

Explanation: Since people cannot naturally acquire immunity to tetanus, the best way to prevent tetanus is to vaccinate your patients.

Correct answer: Vaccine
  • A. Measles
  • B. Hepatitis
  • C. Diphtheria
  • D. Polio

Explanation: They should get one dose at each of the following ages: 2 months old, 4 months old, 6 through 18 months old, and 4 through 6 years old.

Correct answer: Polio
  • A. Fetus receiving antibodies of mother through the placenta
  • B. Mother receiving antibodies
  • C. Baby receiving MMR shots
  • D. Prevention of a disease due to previous infection

Explanation: Artificial active immunity involves the introduction of a vaccine (e.g., MMR shots) containing weakened or inactivated pathogens or their…

Correct answer: Baby receiving MMR shots
  • A. Homeostatic Response
  • B. Primary Immune Response
  • C. Behavioral Response
  • D. Cell-mediated Response

Explanation: Transplant rejection is caused primarily by a cell-mediated immune response to HLA antigens expressed on donor antigen-presenting cells…

Correct answer: Cell-mediated Response
  • A. Neutrophils
  • B. Monocytes
  • C. B-Lymphocytes
  • D. T-Lymphocytes

Explanation: B lymphocytes produce antibodies as part of humoral immunity.

Correct answer: B-Lymphocytes
  • A. 22%
  • B. 28%
  • C. 44%
  • D. 56%

Explanation: In DNA, the amount of adenine (A) equals the amount of thymine (T), and the amount of guanine (G) equals the amount of cytosine (C).

Correct answer: 28%
  • A. 40
  • B. 120
  • C. 360
  • D. 480

Explanation: A polypeptide chain containing 120 amino acids requires a specific number of DNA nucleotides to be coded.

Correct answer: 360
  • A. CGATGGCCTGTCTTCAGAAA
  • B. AAAGACTTCTGCCCGGTAGC
  • C. AAAAACCCCCGGGGGTTTTT
  • D. ACGTGGCCGTTTTCCGAAAA

Explanation: The Sanger sequencing method, or dideoxy chain termination method, involves reading the DNA sequence from the gel electrophoresis results.

Correct answer: CGATGGCCTGTCTTCAGAAA
  • A. 3
  • B. 4
  • C. 6
  • D. 12

Explanation: The section of DNA mentioned in the question can code for amino acids based on groups of three nucleotide bases, known as codons.

Correct answer: 4
  • A. I
  • B. II
  • C. III
  • D. IV

Explanation: Adenine pairs with thymine in DNA replication. Thymine has a single ring in its structure, and the carbon-to-oxygen ratio in pentose is…

Correct answer: I
  • A. 25 amino acids
  • B. 150 amino acids
  • C. 75 amino acids
  • D. 50 amino acids

Explanation: A section of DNA with 150 nucleotides will code for a polypeptide through a process where every three nucleotides (a codon) correspond to…

Correct answer: 50 amino acids
  • A. Genetic codes are redundant
  • B. Genetic codes are ambiguous
  • C. Each amino acid has only one genetic code
  • D. Three genetic codes are used for stop signal

Explanation: The correct answer is that genetic codes are redundant. This means that multiple codons can encode the same amino acid, providing a buffer…

Correct answer: Genetic codes are redundant
  • A. 3
  • B. 4
  • C. 6
  • D. 8

Explanation: In a DNA strand, each nucleotide is connected to the next by a phosphodiester bond.

Correct answer: 6