All Free Biology MCQs with Answers
Every Biology question in the bank, across all chapters, each with the correct answer and a written explanation. Free and unlimited, with no account needed.
19,844 questions · page 814 of 993
- A. Gonorrhea
- B. Syphilis
- C. AIDS
- D. Measles
Explanation: Measles is an acute viral respiratory illness. It is characterized by a prodrome of fever (as high as 105°F) and malaise, cough, coryza…
Correct answer: Measles- A. Syphilis
- B. Measles
- C. Polio
- D. Tetanus
Explanation: Syphilis is considered a sexually transmitted disease (STD) because it is primarily spread through sexual contact, including vaginal…
Correct answer: Syphilis- A. Memory cells are produced in the plasma
- B. Lymphocytes are produced in the bone marrow
- C. T-lymphocytes are required to stimulate the immune system
- D. Antibodies are required to increase the production of B-lymphocytes
Explanation: Memory cells are specialized Lymphocytes that enable a faster response on re-exposure to same pathogen.
Correct answer: Memory cells are produced in the plasma- A. Natural active
- B. Natural passive
- C. Artificial active
- D. Artificial passive
Explanation: The correct answer is artificial passive immunity. This type of immunity occurs when antibodies are directly introduced into the body…
Correct answer: Artificial passive- A. Active and natural
- B. Active and artificial
- C. Passive and natural
- D. Passive and artificial
Explanation: Active artificial immunity is acquired through vaccination but does not provide immediate protection as it requires time for the body to…
Correct answer: Active and artificial- A. Innate immunity
- B. Passive immunity
- C. Primary response
- D. Secondary response
Explanation: Secondary response is faster and stronger due to memory cells.
Correct answer: Secondary response- A. Natural active
- B. Artificial active
- C. Natural passive
- D. Artificial passive
Explanation: Artificial active immunity is the foundation for vaccination. It involves the activation of adaptive immunity through the deliberate…
Correct answer: Artificial active- A. Antibiotic
- B. Pain killers
- C. Vaccine
- D. Sedatives
Explanation: Since people cannot naturally acquire immunity to tetanus, the best way to prevent tetanus is to vaccinate your patients.
Correct answer: Vaccine- A. Measles
- B. Hepatitis
- C. Diphtheria
- D. Polio
Explanation: They should get one dose at each of the following ages: 2 months old, 4 months old, 6 through 18 months old, and 4 through 6 years old.
Correct answer: Polio- A. Fetus receiving antibodies of mother through the placenta
- B. Mother receiving antibodies
- C. Baby receiving MMR shots
- D. Prevention of a disease due to previous infection
Explanation: Artificial active immunity involves the introduction of a vaccine (e.g., MMR shots) containing weakened or inactivated pathogens or their…
Correct answer: Baby receiving MMR shots- A. Homeostatic Response
- B. Primary Immune Response
- C. Behavioral Response
- D. Cell-mediated Response
Explanation: Transplant rejection is caused primarily by a cell-mediated immune response to HLA antigens expressed on donor antigen-presenting cells…
Correct answer: Cell-mediated Response- A. Neutrophils
- B. Monocytes
- C. B-Lymphocytes
- D. T-Lymphocytes
Explanation: B lymphocytes produce antibodies as part of humoral immunity.
Correct answer: B-Lymphocytes- A. 22%
- B. 28%
- C. 44%
- D. 56%
Explanation: In DNA, the amount of adenine (A) equals the amount of thymine (T), and the amount of guanine (G) equals the amount of cytosine (C).
Correct answer: 28%- A. 40
- B. 120
- C. 360
- D. 480
Explanation: A polypeptide chain containing 120 amino acids requires a specific number of DNA nucleotides to be coded.
Correct answer: 360- A. CGATGGCCTGTCTTCAGAAA
- B. AAAGACTTCTGCCCGGTAGC
- C. AAAAACCCCCGGGGGTTTTT
- D. ACGTGGCCGTTTTCCGAAAA
Explanation: The Sanger sequencing method, or dideoxy chain termination method, involves reading the DNA sequence from the gel electrophoresis results.
Correct answer: CGATGGCCTGTCTTCAGAAA- A. 3
- B. 4
- C. 6
- D. 12
Explanation: The section of DNA mentioned in the question can code for amino acids based on groups of three nucleotide bases, known as codons.
Correct answer: 4- A. I
- B. II
- C. III
- D. IV
Explanation: Adenine pairs with thymine in DNA replication. Thymine has a single ring in its structure, and the carbon-to-oxygen ratio in pentose is…
Correct answer: I- A. 25 amino acids
- B. 150 amino acids
- C. 75 amino acids
- D. 50 amino acids
Explanation: A section of DNA with 150 nucleotides will code for a polypeptide through a process where every three nucleotides (a codon) correspond to…
Correct answer: 50 amino acids- A. Genetic codes are redundant
- B. Genetic codes are ambiguous
- C. Each amino acid has only one genetic code
- D. Three genetic codes are used for stop signal
Explanation: The correct answer is that genetic codes are redundant. This means that multiple codons can encode the same amino acid, providing a buffer…
Correct answer: Genetic codes are redundant- A. 3
- B. 4
- C. 6
- D. 8
Explanation: In a DNA strand, each nucleotide is connected to the next by a phosphodiester bond.
Correct answer: 6