All Free Biology MCQs with Answers
Every Biology question in the bank, across all chapters, each with the correct answer and a written explanation. Free and unlimited, with no account needed.
19,844 questions · page 815 of 993
- A. I only
- B. I and II
- C. III only
- D. II and III
Explanation: The correct answer is II and III. During DNA replication, the hydrogen bonds between the base pairs of the two DNA strands are temporarily…
Correct answer: II and III- A. Lack a hydroxyl group
- B. Lack a hydrogen group
- C. Have a nitrogenous base
- D. Have a phosphate group
Explanation: The correct answer is that dideoxy nucleotides lack a hydroxyl group at the 3 carbon.
Correct answer: Lack a hydroxyl group- A. Cell to cell recognition
- B. Passing hereditary information to the next generation
- C. Ensuring fast speed of nerve impulse
- D. Acting as a cell surface marker
Explanation: This is correct as Nucleoproteins are complexes of nucleic acids (DNA or RNA) and proteins.
Correct answer: Passing hereditary information to the next generation- A. Degeneracy
- B. Splicing
- C. Proofreading
- D. Primosome
Explanation: In proofreading, the DNA pol reads the newly added base before adding the next one, so a correction can be made.
Correct answer: Proofreading- A. GATC
- B. GGTT
- C. CGAT
- D. TTCC
Explanation: A palindromic sequence is a nucleic acid sequence in a double-stranded DNA or RNA molecule whereby reading in a certain direction on one…
Correct answer: TTCC- A. Each strand with one new strand and one original strand
- B. Each with two new strands
- C. One with two new strands and one with both original strands
- D. Each with two original strands
Explanation: This is correct. In the semi-conservative model, during DNA replication, each original DNA strand serves as a template for the synthesis…
Correct answer: Each strand with one new strand and one original strand- A. 4
- B. 16
- C. 20
- D. 64
Explanation: Since there are four nucleotides and each trinucleotide consists of three bases, the total number of possible combinations is 43 = 64.
Correct answer: 64- A. DNA polymerase
- B. Ligase
- C. Nucleotides
- D. Primers
Explanation: Given the description of defective DNA molecules formed with normal DNA strands paired with numerous segments of DNA, the most likely…
Correct answer: Primers- A. ACACUAGUGAUGCUAUUCGU
- B. ACACTAGTGATGCTAAACGTG
- C. ACACTAGTGATCCTATTCGTG
- D. CACATCUTUCTUATCTTAUTU
Explanation: The mRNA codons corresponding to the amino acids are:1 (UGU) = Cysteine (Cys)2 (GAU) = Aspartic acid (Asp)3 (CAC) = Histidine (His)4 (UAG)…
Correct answer: CACATCUTUCTUATCTTAUTU- A. 5′-ATGCCAGTA-3′
- B. 5′-ATGACCGTA-3′
- C. 3′-TACGGTCAT-5′
- D. 3′-ATGCCAGTA-5′
Explanation: D is correct one. In the Sanger method, DNA sequencing is achieved by replicating the DNA strand in the presence of chain-terminating…
Correct answer: 3′-ATGCCAGTA-5′- A. Consists of few DNA nucleotides
- B. Helps lo unwind DNA double strand
- C. Prevents DNA strands to pair up
- D. Is a short segment of RNA nucleotides
Explanation: DNA polymerase - an enzyme that adds new nucleotides to a growing strand of DNA.
Correct answer: Is a short segment of RNA nucleotides- A. 0 minutes
- B. 20 minutes
- C. 40 minutes
- D. 60 minutes
Explanation: Right after adding the N15 label, the DNA sample would contain only the heavy isotope N15, so it would appear heaviest at this point.
Correct answer: 0 minutes- A. Gliding joint
- B. Ball and socket joint
- C. Pivot joints
- D. Hinge joint
Explanation: Factual recall. The hip joint and the shoulder joints are examples of ball and socket joints.
Correct answer: Ball and socket joint16294. Unpaired facial bones are:
- A. Maxilla, Zygomatic
- B. Palatine, Inferior concha
- C. Nasal, Lacrimal
- D. Mandible, Vomer
Explanation: Option A: The maxillae are the largest bones in the face and form the upper jaw. The zygomatic bones are the cheekbones.
Correct answer: Mandible, Vomer- A. Fibers
- B. Tracheids
- C. Sclereids
- D. Vessels
- E. Both A and C
Explanation: There are two types of sclerenchyma: (1) fibers, which are long, very narrow cells with sharply tapering end walls; and (2) sclereids…
Correct answer: Sclereids- A. Coccygeal and lumbar
- B. Sacral and lumbar
- C. Sacral and coccygeal
- D. Sacral and thoracic
Explanation: The single sacrum is formed by the fusion of five sacral vertebrae. Similarly, the coccyx or tailbone, results from the fusion of four…
Correct answer: Sacral and coccygeal- A. Carpals
- B. Metacarpals
- C. Phalanges
- D. Tarsal
- E. Radius
Explanation: In the palm of the hand, there are metacarpal bones, as shown below:
Correct answer: Metacarpals- A. Fibrous joints
- B. Sliding joints
- C. Pivot joints
- D. Hinge joints
- E. Gliding joints
Explanation: Bones of the skull are joined by fibrous joints, which are immovable and fixed types of joints.
Correct answer: Fibrous joints- A. Hydrotropism
- B. Chemotropism
- C. Geotropism
- D. Thigmotropism
- E. Phototropism
Explanation: Thigmotropism is a directional growth movement that occurs as a mechanosensory response to a touch stimulus.
Correct answer: Thigmotropism16300. Pseudopodia are:
- A. False feet developed in some unicellular organisms
- B. Small hairlike structures present on the unicellular organisms
- C. Long, tube like structures coming out of the mouth
- D. Suckers which are attached to the walls of intestines
Explanation: A pseudopod or pseudopodia is a temporary arm-like projection of a eukaryotic cell membrane that emerges in the direction of movement.
Correct answer: False feet developed in some unicellular organisms