All Free Biology MCQs with Answers

Every Biology question in the bank, across all chapters, each with the correct answer and a written explanation. Free and unlimited, with no account needed.

19,844 questions · page 815 of 993

  • A. I only
  • B. I and II
  • C. III only
  • D. II and III

Explanation: The correct answer is II and III. During DNA replication, the hydrogen bonds between the base pairs of the two DNA strands are temporarily…

Correct answer: II and III
  • A. Lack a hydroxyl group
  • B. Lack a hydrogen group
  • C. Have a nitrogenous base
  • D. Have a phosphate group

Explanation: The correct answer is that dideoxy nucleotides lack a hydroxyl group at the 3 carbon.

Correct answer: Lack a hydroxyl group
  • A. Cell to cell recognition
  • B. Passing hereditary information to the next generation
  • C. Ensuring fast speed of nerve impulse
  • D. Acting as a cell surface marker

Explanation: This is correct as Nucleoproteins are complexes of nucleic acids (DNA or RNA) and proteins.

Correct answer: Passing hereditary information to the next generation
  • A. Degeneracy
  • B. Splicing
  • C. Proofreading
  • D. Primosome

Explanation: In proofreading, the DNA pol reads the newly added base before adding the next one, so a correction can be made.

Correct answer: Proofreading
  • A. GATC
  • B. GGTT
  • C. CGAT
  • D. TTCC

Explanation: A palindromic sequence is a nucleic acid sequence in a double-stranded DNA or RNA molecule whereby reading in a certain direction on one…

Correct answer: TTCC
  • A. Each strand with one new strand and one original strand
  • B. Each with two new strands
  • C. One with two new strands and one with both original strands
  • D. Each with two original strands

Explanation: This is correct. In the semi-conservative model, during DNA replication, each original DNA strand serves as a template for the synthesis…

Correct answer: Each strand with one new strand and one original strand
  • A. 4
  • B. 16
  • C. 20
  • D. 64

Explanation: Since there are four nucleotides and each trinucleotide consists of three bases, the total number of possible combinations is 43 = 64.

Correct answer: 64
  • A. ACACUAGUGAUGCUAUUCGU
  • B. ACACTAGTGATGCTAAACGTG
  • C. ACACTAGTGATCCTATTCGTG
  • D. CACATCUTUCTUATCTTAUTU

Explanation: The mRNA codons corresponding to the amino acids are:1 (UGU) = Cysteine (Cys)2 (GAU) = Aspartic acid (Asp)3 (CAC) = Histidine (His)4 (UAG)…

Correct answer: CACATCUTUCTUATCTTAUTU
  • A. 5′-ATGCCAGTA-3′
  • B. 5′-ATGACCGTA-3′
  • C. 3′-TACGGTCAT-5′
  • D. 3′-ATGCCAGTA-5′

Explanation: D is correct one. In the Sanger method, DNA sequencing is achieved by replicating the DNA strand in the presence of chain-terminating…

Correct answer: 3′-ATGCCAGTA-5′
  • A. Consists of few DNA nucleotides
  • B. Helps lo unwind DNA double strand
  • C. Prevents DNA strands to pair up
  • D. Is a short segment of RNA nucleotides

Explanation: DNA polymerase - an enzyme that adds new nucleotides to a growing strand of DNA.

Correct answer: Is a short segment of RNA nucleotides
  • A. 0 minutes
  • B. 20 minutes
  • C. 40 minutes
  • D. 60 minutes

Explanation: Right after adding the N15 label, the DNA sample would contain only the heavy isotope N15, so it would appear heaviest at this point.

Correct answer: 0 minutes
  • A. Gliding joint
  • B. Ball and socket joint
  • C. Pivot joints
  • D. Hinge joint

Explanation: Factual recall. The hip joint and the shoulder joints are examples of ball and socket joints.

Correct answer: Ball and socket joint
  • A. Maxilla, Zygomatic
  • B. Palatine, Inferior concha
  • C. Nasal, Lacrimal
  • D. Mandible, Vomer

Explanation: Option A: The maxillae are the largest bones in the face and form the upper jaw. The zygomatic bones are the cheekbones.

Correct answer: Mandible, Vomer
  • A. Fibers
  • B. Tracheids
  • C. Sclereids
  • D. Vessels
  • E. Both A and C

Explanation: There are two types of sclerenchyma: (1) fibers, which are long, very narrow cells with sharply tapering end walls; and (2) sclereids…

Correct answer: Sclereids
  • A. Coccygeal and lumbar
  • B. Sacral and lumbar
  • C. Sacral and coccygeal
  • D. Sacral and thoracic

Explanation: The single sacrum is formed by the fusion of five sacral vertebrae. Similarly, the coccyx or tailbone, results from the fusion of four…

Correct answer: Sacral and coccygeal
  • A. Carpals
  • B. Metacarpals
  • C. Phalanges
  • D. Tarsal
  • E. Radius

Explanation: In the palm of the hand, there are metacarpal bones, as shown below:

Correct answer: Metacarpals
  • A. Fibrous joints
  • B. Sliding joints
  • C. Pivot joints
  • D. Hinge joints
  • E. Gliding joints

Explanation: Bones of the skull are joined by fibrous joints, which are immovable and fixed types of joints.

Correct answer: Fibrous joints
  • A. Hydrotropism
  • B. Chemotropism
  • C. Geotropism
  • D. Thigmotropism
  • E. Phototropism

Explanation: Thigmotropism is a directional growth movement that occurs as a mechanosensory response to a touch stimulus.

Correct answer: Thigmotropism

16300. Pseudopodia are:

  • A. False feet developed in some unicellular organisms
  • B. Small hairlike structures present on the unicellular organisms
  • C. Long, tube like structures coming out of the mouth
  • D. Suckers which are attached to the walls of intestines

Explanation: A pseudopod or pseudopodia is a temporary arm-like projection of a eukaryotic cell membrane that emerges in the direction of movement.

Correct answer: False feet developed in some unicellular organisms